mhall318200435 mhall318200435
  • 02-11-2020
  • History
contestada

What was Tennessee’s process for readmission to the union

Respuesta :

4804307315 4804307315
  • 02-11-2020
Aftermath. After the war, Tennessee adopted a constitutional amendment forbidding human property on February 22 , 1865
Answer Link

Otras preguntas

How is the creation of public policy in Russia different from that in the United States?
I=$310 P=$1,000 t=5 years
If a family has three children, what is the probability that the family has at least one girl?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Who basically "began" England's religious reformation?
What is the difference in elevation between a plane flying at 25,500 ft above sea level and a submarine traveling 450 ft below sea level?
what does the liver do in the excretory system
which statement about nuclear fusion is correctA) Two hydrogen electrons become protons during fusion B) Helium nuclei xan fuse to form electrons such as nitrog
a food worker prepares a raw fish fillet for cooking. what food hazard must be removed during preparation?
which department or agency conducts foreign policy and protects u s citizens in other countries?