haileejohnson747 haileejohnson747

04-01-2021
Mathematics

contestada

A square postage stamp has area 1,190mm to the second power

Respuesta :

chaliebaker chaliebaker

04-01-2021

Answer:

0.00119 m2

Step-by-step explanation:

Answer Link

Otras preguntas

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

i need help with this

What is the definition of leanness?

35 Mr. Brown is flying his single-engine plane at an altitude of 1800 feet. He sees a cornfield at an angle of depression of 35º. Which equation can be used to

Urgent question I didn't know what topic to put this under but. Today I had serve chest pain shortness of breath and the pain was unbearable what was maybe wron

fill in the blanks Banks take money that is unused by ___________ and lend it to people who want to ___________ or buy things that they can’t immediately afford

Which of the following statements says that a number is between -5 and 5? |x| > 5 |x| < 5 |x| = 5

Cosas que e echo para sobrellevar de mejor manera la pandemia

Flexibility exercise can be done everyday. True or false

WHOEVER GIVES CORRECT ANSWER I WILL MARK BRAINIEST What is the slope of the line?Explain how you calculated the slope in the graph going through the points (-6,