ranabhatsaugat ranabhatsaugat
  • 02-11-2021
  • English
contestada

he helped him yesterday into simple future

Respuesta :

mikhaeldonbosco
mikhaeldonbosco mikhaeldonbosco
  • 27-02-2022

Answer:

He will help him tomorrow.

Explanation:

Answer Link

Otras preguntas

Byron uses a poetic technique called _____ to force the reader to _____. A. enjambment; move from one line to the next without pause B. iambic pentameter; pa
Write one or two sentences about the main idea or purpose of the article.
2. You must use headlights when driving ___________________. A. between sunset and sunrise B. in rain C. half hour after sunset and half hour before sunrise D.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
The term used when an organism is studied in its natural environment is
Do cones and polyhedrons both have only one base true or false
Helppppp how do u do this????
Multivitamin/mineral supplements should never be given to toddlers. a. True b. False
what are good websites to study for biology?
What law required Northerners to assist in the return of runaway slaves