anarobles5532 anarobles5532
  • 04-01-2022
  • Social Studies
contestada

what food is traditionally eaten for luck in the southern u.s. on new year’s day?

Respuesta :

flyingandfalling324 flyingandfalling324
  • 04-01-2022
they eat chowder for luck
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what was paul revere failures
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
Graph the first six terms of a sequence where a1 = -10 and d = 3.
What kind of problems did increased urbanization cause? During time of industrial revolution
How did the mountains in Greece contribute to the rise of city-states?
What is the sum of 6/10 plus 7/12
Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn