janna4444444 janna4444444

03-05-2022
Mathematics

contestada

-2x - 3y = -7
y = 6x - 11
O (4,3)
• (2,1)
O (1,2)
O (2,3

2x 3y 7 y 6x 11 O 43 21 O 12 O 23 class=

Respuesta :

shownubear1992 shownubear1992

03-05-2022

Answer:

[tex]B.(2,1)[/tex]

Step-by-step explanation:

Ver imagen shownubear1992

Answer Link

Otras preguntas

Simplify the expression: (5a^4b^2)^3(-2b^4)

Determine the number of real solutions each quadratic equation has. y = 12x2 - 9x + 4 __ real solution(s) 10x + y = -x2 + 2 __ real solution(s) 4y - 7 = 5x2 -

Find the area of a kite with diagonals 10 & 5

What is true concerning an ecological community? it is a large region of multiple organisms the boundaries, large or small, of a single organism the ecosystem o

what does a light year measure

The the flourishing of a vibrant black culture in the 1920s in new york city, called _____, was inspired by countee cullen, langston hughes, and claude mckay.

How many neutrons does element X have if its atomic number is 31 and its mass number is 90?

Fill in each blank with mitosis or meiosis. humans produce gametes by the process of __________________. a zygote becomes a fetus by the process of_____________

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which constitutional amendment allowed voting for citizens who were eighteen or older?