KemiahZ79139 KemiahZ79139
  • 04-11-2022
  • Mathematics
contestada

iIs - sqrt{25} a rational or irrational number?is it a rational or irrational number?

Respuesta :

AlanoudL594555 AlanoudL594555
  • 04-11-2022

We know that a rational number can be written in the form: a / b.

In this case, we have that:

[tex]-\sqrt[]{25}=-(5)=-5[/tex]

That is, the result is -5. Therefore, we can rewrite this number as:

[tex]-\frac{5}{1}=-5[/tex]

Hence, - sqrt(25) is a rational number.

Answer Link

Otras preguntas

can someone help me im at 99 percent on khan and i have the final skill at level one but i just can't get the mastery challege
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
If WZYX Is congruent to PMLN describes two quadrilaterals, which other statement is also true? WXYZ Is congruent to LMNP WXYZ Is congruent to NPML WXYZ Is co
Based on his background, is Private Burnett's account trustworthy? Why or why not?
Describe the main function of the following parts. 1. leaves 4. roots 2. stem 5. flowers 3. veins 6. petals
The linear equation y = 3x + 2 has slope 3 and y-intercept
a) The principal said to me, "Are you fine today?"​
The linear equation y = 3x + 2 has slope 3 and y-intercept
Find the sum of the first 25 terms in this geometric series: 8 + 6 + 4.5...
Make a rectangle That has the width X +2 And a Length x+3. Give the perimeter of the shape. Write the area in two different ways