icebox55aa icebox55aa

01-08-2017
Health

contestada

Which of these is a muscle-building exercise? heating Weightlifting stretching relaxation

Respuesta :

aruthj2001otptxe aruthj2001otptxe

01-08-2017

Weightlifting is the answer.

Answer Link

01-08-2017

hi !

Weighlifting is a muscle-building exercise

bye

Answer Link

Otras preguntas

Boxes A and B contain some counters.is 8y + 1 counters 6y + 9 counters Box A Box B The number of counters in each box is the same. Work out the value of y

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Wilmington Company reported pretax income of $25,000 during 2018 and $30,000 during 2019. Later it was discovered that the ending inventory for 2018 was underst

Why did French in Anglo-Saxons languages merge

What is Nomadic herding?

The reaction below has a Kp value of 3.3 × 10-5. What is the value of Kc for this reaction at 700 K? Note: Type the correct answer with 1 decimal place and in s

If point F is translated 3 units to the right and 6 units up, what are the coordinates of F?

Darwin developed and proposed the Theory of Evolution during the 1800s. Since that time, due in part to advances in technology, scientists have expanded their k

What is the volume? 9 m 19 m 7 m

Words that end in -ily are usually – A. verbs B. pronouns c. nouns D. adverbs