Bechy1977 Bechy1977
  • 04-10-2017
  • History
contestada

Which conquistador gained control of the Inca Empire? What country is it today?

Respuesta :

Аноним Аноним
  • 04-10-2017
Peru is the country that gained control.
Answer Link

Otras preguntas

What are some methods used by Mussolini to rise to power?
the reproductive system of a male mammal provides
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
an explanation describe if a square-eyed pet mates with another square-eyed pet, can they have any round-eyed offspring.
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
the reproductive system of a male mammal provides
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe