MimiDaBest2892 MimiDaBest2892

01-02-2018
History

contestada

One of the basic liberties sought by the colonists

Respuesta :

calisilvers2121 calisilvers2121

06-02-2018

That would be religious freedom
Hope that helps

Answer Link

Otras preguntas

help asap homework due soon 20 pts Read each verbal expression Then assign a variable and distribute

(50)points 5 questions

Molly is buying a house for $202,000. she is financing $185,500 and obtained a 30 year fixed rate mortgage with a 5.125% interest rate. How much are her month

Read each verbal expression Then assign a variable and distribute

a triangle has a measure of 30. The other two angles are in a ratio of 7:8. What are the measures of those two angles?

Which of the following has 20 faces? A. Tetrahedron B. Dodecahedron C. Octahedron D. Icosahedron

What does this passage suggest about truman's reasons for declaring his doctrine? he thinks the doctrine is necessary to protect the united states as well as ot

I WILL MARK BRAINIEST AND GIVE 50 POINTS 4. Analyze what would happen to this ecosystem if one of the primary consumers was removed from the ecosystem? What wou

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Aerial photographs most often are taken from __________. A. aircrafts B. hot air balloons C. satellites D. space shuttles