gabrielafloresp6kxmz gabrielafloresp6kxmz
  • 03-04-2018
  • Chemistry
contestada

Find x. Round to the nearest hundredth if necessary.

Find x Round to the nearest hundredth if necessary class=

Respuesta :

minjooniee
minjooniee minjooniee
  • 03-04-2018
Is there more than one triangle in this problem? Or is this the only one (and that we only know 7 and x are the sides).
Answer Link

Otras preguntas

Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
Graph the first six terms of a sequence where a1 = -10 and d = 3.
who fought against each other in the crusades?
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
What is the difference between "Herr" and "Herrn"?
In which system of government would states function independently of each other?
Susan ........ (Run) to school because she was late.