alex0225 alex0225

04-09-2019
Mathematics

contestada

im a little stuck on this (please show how you did it)

im a little stuck on this please show how you did it class=

Respuesta :

meredith48034 meredith48034

04-09-2019

Answer:

all work is shown / pictured

Ver imagen meredith48034

Answer Link

Otras preguntas

how far did this person travel in Section C ( hours 6-7) Remember to include units

Explain in your own words why it is sufficient to find the x-intercept and y- intercept to graph a line.

Someone please explain I am so confused

why are graphs of compound inequalities helpful?

Please help!! Which statement is a theme of the story "Coming Through Fog"? A)Family members can be different but still lov

How did the Puritans influence the development of the Massachusetts Bay Colony? They made sure that the traditions of the Church of England continued in the col

Fill in the blank with the Spanish word that best completes the following sentence. Susana va a ____________ una medalla en las Olimpiadas. ganar bailar bajar e

a car is moving with a velocity of 25m/s for 15s. calculate the displacement of the car. The acceleration of the car over the 15s

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Amassing capital was his primary goal. (a) city where government is located, (b) punishable by death, (c) money