zeidyamelie zeidyamelie
  • 02-12-2020
  • Mathematics
contestada

Simplify the expression.
49^3/2

Respuesta :

james872
james872 james872
  • 02-12-2020

Answer:

i think its 58824.5

Answer Link

Otras preguntas

What is the distance between points (-42, 63) and (-39, 67)?
Thinking about suicide is called _________, and a suicide attempt that is not completed is called __________.
What is true about the energy involved in a chemical reaction? (3 points) The amount of energy is constant, but it is converted from one form to another. T
Ully is having a party and wants to fill his swimming pool. if he only uses his hose it takes 2 hours more than if he only uses his neighbor's house. of houses
Find the area bounded by the curves x = y2 - 4y and x = 2y - y2. Your work must include an integral in one variable.
What allows small vertical movements to grow until they produce turbulent airflow?
I'm doing C++. When i multiply 200000 by 200000, i get 1345294336. I wrote long long x = 200000 * 200000 cout << x << endl;
what are the zeros of the polynomial x2+4x-12
How did the triple alliance and the triple entente change during the war?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat