anastaciatooswaggy anastaciatooswaggy
  • 02-06-2021
  • Physics
contestada

A plane travels at an average speed of 600 kilometers per hour. How long
does it take the plane to travel 120 kilometers?

Respuesta :

machmillerg
machmillerg machmillerg
  • 02-06-2021

Answer:

12 mins

Explanation:

120km/600km = 1/5 or .2

60mins*0.2 = 12 mins

Answer Link

Otras preguntas

3∙(a+x), if a=8; x=−10
__________ involves a rapid loss that occurs just before death. primary aging pathological aging secondary aging tertiary aging
PLEASE HELP ASAP simplify (3x^2 - 3 + 9x^3) - (4x^3 - 2x^2 + 16).x^3 - 5x^2 + 25-x^3 + x^2 + 255x^3 + 2x + 13 5x^3 + 5x^2 - 19
what is the difference in length between a 1 and 1/4 inch button and a 3/8 inch button
which of the following statements agrees with the second law of thermodynamics
What is the area of this composed figure
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
If you dissolve 14.2 grams of licl in enough water to make 0.450 l of solutions, what is the molarity of the solution?
What advice would you give someone whose life dream is to become a judge?
A hexahedron is a prism whose base is a _____. A. equilateral triangle B. square C. circle D. triangle